Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.192405 |
Chromosome: | chromosome 10 |
Location: | 96182 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g418300 | (1 of 30) PF03407 - Nucleotide-diphospho-sugar transferase (Nucleotid_trans) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCCATGGTTTCCCTCGTTTGCACCTGTT |
Internal bar code: | GGCGAGCCGCCGCTGCTAGAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 957 |
LEAP-Seq percent confirming: | 94.5176 |
LEAP-Seq n confirming: | 2655 |
LEAP-Seq n nonconfirming: | 154 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTGTTCATCCGCAACAGC |
Suggested primer 2: | ACCTCAAACACAGTCCCCTG |