| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.192474 |
| Chromosome: | chromosome 16 |
| Location: | 554153 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g692550 | MSH4 | DNA mismatch repair protein, MutS homolog; (1 of 1) K08740 - DNA mismatch repair protein MSH4 (MSH4) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGGATTCGGCTAGCTCTTCTGGGGGCGC |
| Internal bar code: | GGGGTCTAAAAACCGACACCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 506 |
| LEAP-Seq percent confirming: | 99.5726 |
| LEAP-Seq n confirming: | 1398 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTAGCACTGCTGACACAT |
| Suggested primer 2: | CTGACCCAGATCAAGCAACA |