Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.192581 |
Chromosome: | chromosome 4 |
Location: | 3553007 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g228350 | DLA4 | (1 of 1) 2.3.1.168 - Dihydrolipoyllysine-residue (2-methylpropanoyl)transferase / Dihydrolipoyl transacylase; Dihydrolipoamide acetyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGCTCACACCCTGCCATCCGCAACCCT |
Internal bar code: | TCGTGCAAGTTTATCCTGCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 167 |
LEAP-Seq percent confirming: | 78.6644 |
LEAP-Seq n confirming: | 907 |
LEAP-Seq n nonconfirming: | 246 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCAACATAAAGCAGGTGT |
Suggested primer 2: | CGTGTGTCGCAAACTGTCTT |