| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.192635 |
| Chromosome: | chromosome 14 |
| Location: | 1598234 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g618860 | SRH24 | (1 of 1) K11320 - E1A-binding protein p400 [EC:3.6.4.-] (EP400); SNF2-related DNA/RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGTGCACGGGATGCGAGCCGCTGCTTGA |
| Internal bar code: | TTAGGGGACCCTGTTTTGTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 565 |
| LEAP-Seq percent confirming: | 99.4224 |
| LEAP-Seq n confirming: | 5164 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGTACCAGCAGCAACAGC |
| Suggested primer 2: | GTGCATGACACCCTATGTGC |