Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.192637 |
Chromosome: | chromosome 16 |
Location: | 2906073 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g663800 | TPT25,CGL51 | Conserved in the Green Lineage; (1 of 1) PTHR11132:SF88 - XYLULOSE 5-PHOSPHATE/PHOSPHATE TRANSLOCATOR, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCGGATTCATACTAGACAATATGTGTAC |
Internal bar code: | ACACGAAGTGCGGAGGCAGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 200 |
LEAP-Seq percent confirming: | 93.5268 |
LEAP-Seq n confirming: | 419 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCCCCTTGATCTCACTCAC |
Suggested primer 2: | ACCTTGTGTACCCAGAACGC |