Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.192837 |
Chromosome: | chromosome 9 |
Location: | 2532750 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390957 | (1 of 6) IPR001471//IPR016177 - AP2/ERF domain // DNA-binding domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATCCAAACGGCACGCAGCAGCAGGTTGC |
Internal bar code: | GCCTCCGATTTGAGCGGAGCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1005 |
LEAP-Seq percent confirming: | 99.8036 |
LEAP-Seq n confirming: | 3557 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAAGTCAAGTCAGCAACCG |
Suggested primer 2: | CCTGAGCAAAGTAGAACGGC |