| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.192857 |
| Chromosome: | chromosome 5 |
| Location: | 3044490 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238687 | PHC35 | Pherophorin-chlamydomonas homolog 35; (1 of 1) IPR011993//IPR024616 - Pleckstrin-homology domain (PH domain)/Phosphotyrosine-binding domain (PTB) // Pherophorin | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAGAGCCCCGTGCGGAGACGTTTCTTCC |
| Internal bar code: | AAAACTTCTTTACCATGTACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 825 |
| LEAP-Seq percent confirming: | 99.7248 |
| LEAP-Seq n confirming: | 5074 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGATGCATGATCCCTCTG |
| Suggested primer 2: | TGCAAGAGTGATCAGCAACC |