Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.192877 |
Chromosome: | chromosome 3 |
Location: | 8957401 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g208833 | (1 of 1) K10896 - fanconi anemia group M protein (FANCM) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGAGGAGCGGCGGGAGGAGGAGGCGAAG |
Internal bar code: | CGTGTACACAGTCAACAGCACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 85 |
LEAP-Seq percent confirming: | 3.49538 |
LEAP-Seq n confirming: | 87 |
LEAP-Seq n nonconfirming: | 2402 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAACCACACCAACATCAAG |
Suggested primer 2: | TACTGAACAGGCTGAAGCGA |