Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.192922 |
Chromosome: | chromosome 6 |
Location: | 1915700 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g263450 | EEF1A3 | (1 of 3) K03231 - elongation factor 1-alpha (EEF1A); Putative eukaryotic translation initiation factor 1 alpha | 5'UTR_intron|intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAATGTCACCTATGTTTGACGCTTACCCG |
Internal bar code: | CGGATAGGGGGGTGTTCGCATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1041 |
LEAP-Seq percent confirming: | 97.9592 |
LEAP-Seq n confirming: | 432 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTCTTTATTCCCTGACCA |
Suggested primer 2: | ACCTTGTGGTCACCCTTCTG |