| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.192928 |
| Chromosome: | chromosome 1 |
| Location: | 7379475 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g053000 | GPD1,GPDH2,GPD2 | (1 of 3) K00006 - glycerol-3-phosphate dehydrogenase (NAD+) (GPD1); Glycerol-3-phosphate dehydrogenase/dihydroxyacetone-3-phosphate reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGACTGTGCGCAATCCATCGCACAGAA |
| Internal bar code: | CTAGCCTCTAGCTATTTTGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 750 |
| LEAP-Seq percent confirming: | 99.4736 |
| LEAP-Seq n confirming: | 5480 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCCTGCTGCTAGCCATAC |
| Suggested primer 2: | CAGCAACAGCGTGTAAAGGA |