Insertion junction: LMJ.RY0402.193072_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.193072
Chromosome:chromosome_6
Location:5288307
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g282800 ICL1 Isocitrate lyase sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTGGATGGGCAATACACAGCCCTGGCCACG
Internal bar code:GTTGGCGGTCCCGATCGGGGCT

Confirmation - LEAP-Seq

LEAP-Seq distance:541
LEAP-Seq percent confirming:99.7059
LEAP-Seq n confirming:678
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:TAGCTGAGGCTGGTGATGTG
Suggested primer 2:ACCCACACCACCACCACTAT