| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.193094 |
| Chromosome: | chromosome 17 |
| Location: | 3971206 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728700 | (1 of 1) K11228 - mitogen-activated protein kinase kinase kinase (STE11) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTTAACAAGGGCGGAATGGGCGACACAC |
| Internal bar code: | TCTCATCCGATATCGCGACCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 410 |
| LEAP-Seq percent confirming: | 99.7489 |
| LEAP-Seq n confirming: | 1986 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCGCTAGAGCACGAGAT |
| Suggested primer 2: | TTTGGTTTAGTTTGGGCTGG |