| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.193249 |
| Chromosome: | chromosome 10 |
| Location: | 6217228 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464450 | (1 of 2) PF00651//PF07707 - BTB/POZ domain (BTB) // BTB And C-terminal Kelch (BACK) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTTCCTCTCAAAACCCTACTTCTCCTCC |
| Internal bar code: | AAGGTGGTAAGGAGGCAGTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 116 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 140 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCTCAAAGAAGCAGTCCG |
| Suggested primer 2: | TCTGGACAATGCCACCATTA |