| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.193485 |
| Chromosome: | chromosome 10 |
| Location: | 2534076 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g436650 | HEL45 | (1 of 1) PTHR24031//PTHR24031:SF181//PTHR24031:SF50 - RNA HELICASE // DEAD-BOX ATP-DEPENDENT RNA HELICASE 50 // DEAD/DEAH BOX RNA HELICASE FAMILY PROTEIN; DEAD/DEAH box helicase-related protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCCCCACTCCCCCGCCTGCCCTGTGT |
| Internal bar code: | GCGCGAGCAGAAGCATAGGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 318 |
| LEAP-Seq percent confirming: | 98.4436 |
| LEAP-Seq n confirming: | 1518 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGTGGACAGGTGGGTAG |
| Suggested primer 2: | TCTGTACTCGCCCTTTACCG |