| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.193591 |
| Chromosome: | chromosome 16 |
| Location: | 5925666 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677050 | (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTCTAGGCTTGGGCATTTAACTTCTCCC |
| Internal bar code: | CTCCCGGAAATTGCAGCGGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 479 |
| LEAP-Seq percent confirming: | 99.8985 |
| LEAP-Seq n confirming: | 984 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATCACGAAACCCAAGGAG |
| Suggested primer 2: | TACCGGTATGTAGAAGGCGG |