| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.193606 |
| Chromosome: | chromosome 3 |
| Location: | 7502757 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205400 | (1 of 1) PF01344//PF07707 - Kelch motif (Kelch_1) // BTB And C-terminal Kelch (BACK) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCACCGTGTCAAAACACTCCACGGACT |
| Internal bar code: | TCAGTCGCGCGACTTACCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 6.47182 |
| LEAP-Seq n confirming: | 248 |
| LEAP-Seq n nonconfirming: | 3584 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAATGCTACCACCGCCCTAC |
| Suggested primer 2: | CAGCTCTAGGGACTGTTGCC |