| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.193609 |
| Chromosome: | chromosome 17 |
| Location: | 3633057 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g726300 | uS14m,MRPS14 | Mitochondrial ribosomal protein S14; (1 of 3) PF00253 - Ribosomal protein S14p/S29e (Ribosomal_S14) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTACAAGAAGGGGCAGTCCGACCAAGCAA |
| Internal bar code: | TTCGCAGTATTGCTACAACCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 206 |
| LEAP-Seq percent confirming: | 92.4242 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTACGGCAAGCCATTTT |
| Suggested primer 2: | TGTTCGCCAAGAGTTCACTG |