Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.193643 |
Chromosome: | chromosome 16 |
Location: | 4748803 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g686750 | PTA3 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain; Proton/phosphate symporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATGTAGGCAGGAGATTTAGAGCGTCCC |
Internal bar code: | AGCATTTTCAGGCCCTACAGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 910 |
LEAP-Seq percent confirming: | 99.3781 |
LEAP-Seq n confirming: | 3036 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCGTGTCCAAGCCTACAGT |
Suggested primer 2: | GTGAGTAGGGAGACGGTGGA |