Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.193757 |
Chromosome: | chromosome 2 |
Location: | 1978457 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g088200 | PDI1,cPDI,RB60 | (1 of 1) K09580 - protein disulfide-isomerase A1 (PDIA1, P4HB); Protein disulfide isomerase 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTGCTGTGTTGCCTCGGCGCTTCTGTCG |
Internal bar code: | AGTCTCCGGCTCGGGGGCGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 98 |
LEAP-Seq percent confirming: | 98.9362 |
LEAP-Seq n confirming: | 279 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGATGAGCTGTGTAGACGA |
Suggested primer 2: | ATGGTGCTCGTAACCCTGAC |