| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.193787 |
| Chromosome: | chromosome 17 |
| Location: | 1896115 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g710200 | IAD1 | Indoleamine 2%252C3-dioxygenase; (1 of 1) 1.13.11.11 - Tryptophan 2,3-dioxygenase / Tryptophanase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCTCCAAGACTTGCGGCGTCAGTGCCGC |
| Internal bar code: | CGGGGGTCCGGAGCCGAGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1015 |
| LEAP-Seq percent confirming: | 97.7408 |
| LEAP-Seq n confirming: | 3115 |
| LEAP-Seq n nonconfirming: | 72 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCCTAACGGCTTCTCCCT |
| Suggested primer 2: | AAGAGGAAGCGTGGCTTACA |