| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.193899 |
| Chromosome: | chromosome 11 |
| Location: | 1702874 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467781 | ARB1,FAP151 | (1 of 2) K06185 - ATP-binding cassette, subfamily F, member 2 (ABCF2); Soluble ABC-F domain containing protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGTAAGAGGGAGGGTTGGGAGGGAGGG |
| Internal bar code: | ACGGGGGCCATAGGGAGGGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 576 |
| LEAP-Seq percent confirming: | 98.9583 |
| LEAP-Seq n confirming: | 95 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCTCGAATCCCCACACAC |
| Suggested primer 2: | CTAACGCCAAGTTCGCTAGG |