Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.193950 |
Chromosome: | chromosome 10 |
Location: | 2942517 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g440450 | PSB28 | (1 of 1) K08903 - photosystem II 13kDa protein (psb28); Photosystem II associated subunit 28 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGTGGGATCGCTTCATGCGCTTCATGGA |
Internal bar code: | GGGCGAGAAGGCTAGAGCTCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1077 |
LEAP-Seq percent confirming: | 99.5434 |
LEAP-Seq n confirming: | 218 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTACACCCCGCTAACTGACC |
Suggested primer 2: | TGCGCAGAGGCATACAATAG |