Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.194023 |
Chromosome: | chromosome 12 |
Location: | 5521679 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g531200 | FOX2 | Multicopper ferroxidase; (1 of 2) K14735 - hephaestin (HEPH) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGTCCTGGGTAGCATTGGGCCGGACGTG |
Internal bar code: | ACCTCCGGGTAGTCGGGGGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 2.01863 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 631 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAAAGCCGTCGTGAAGAGC |
Suggested primer 2: | TATCGAGTGTTGGTCGCAAG |