| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.194067 |
| Chromosome: | chromosome 10 |
| Location: | 2993819 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440850 | GPX4 | Glutathione peroxidase 4; (1 of 2) 1.11.1.12 - Phospholipid-hydroperoxide glutathione peroxidase / Peroxidation-inhibiting protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGTGATAGCGGCACAGGAACTGACGTG |
| Internal bar code: | ACATATGAGGCCCCATGAACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 2.44173 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 879 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGCCAGAACGAGCTCACC |
| Suggested primer 2: | CTTAAACGACTAGCGGCCTG |