| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.194092 |
| Chromosome: | chromosome 17 |
| Location: | 4435545 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g731950 | ATP9B | Mitochondrial F1F0 ATP synthase subunit 9, isoform B; (1 of 2) K02128 - F-type H+-transporting ATPase subunit c (ATPeF0C, ATP5G, ATP9) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATGCGACACACAGTAGTGAGCGTACACG |
| Internal bar code: | GACCGTCAAATAGATTGACGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGAAACCATCAATCAAGC |
| Suggested primer 2: | CAGCACGCTTCTGCTTGTAG |