| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.194165 |
| Chromosome: | chromosome 7 |
| Location: | 5671198 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g352400 | IPP5 | Inositol polyphosphate related phosphatase; (1 of 2) 3.1.3.56 - Inositol-polyphosphate 5-phosphatase / Type I inositol-polyphosphate phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCGGATGCCTGGGTGCGGCTTTTTGCCG |
| Internal bar code: | GGTCCATGAAGCGTCGATTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 230 |
| LEAP-Seq percent confirming: | 99.695 |
| LEAP-Seq n confirming: | 4576 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTATAGGCAAGCAGGAAGC |
| Suggested primer 2: | TTTGCAAACAGGTATCGCAC |