Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.194175 |
Chromosome: | chromosome 13 |
Location: | 2884050 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g583500 | TAF2,GEX2 | (1 of 5) IPR000104//IPR016024 - Antifreeze protein, type I // Armadillo-type fold | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTTGATCTGTTTATGGTACCTGACGGG |
Internal bar code: | TAGGGCATTCACCATTCGGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 0.0 |
LEAP-Seq n confirming: | 0 |
LEAP-Seq n nonconfirming: | 605 |
LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACTTGGGTGACGCCTCTT |
Suggested primer 2: | AGTTGGATTGTGTTCCAGCC |