| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.194204 |
| Chromosome: | chromosome 10 |
| Location: | 1673224 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g429880 | CGL156 | DNA binding protein; (1 of 1) IPR001606//IPR001965//IPR003754//IPR011011//IPR019787 - ARID DNA-binding domain // Zinc finger, PHD-type // Tetrapyrrole biosynthesis, uroporphyrinogen III synthase // Zinc finger, FYVE/PHD-type // Zinc finger, PHD-finger | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTACGAGACTCGCGGTGGCCGTGGTCGT |
| Internal bar code: | AAGAGTATGGCGGCATAGACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 320 |
| LEAP-Seq percent confirming: | 99.7517 |
| LEAP-Seq n confirming: | 12858 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTCAGGATGGCGTAAGT |
| Suggested primer 2: | ATCTACCACGCAGGTGTTCC |