| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.194273 |
| Chromosome: | chromosome 10 |
| Location: | 2409396 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435500 | EFT2 | (1 of 1) IPR001816//IPR009060//IPR014039 - Translation elongation factor EFTs/EF1B // UBA-like // Translation elongation factor EFTs/EF1B, dimerisation; elongation factor Ts-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGCCCCAGGCGCCCCACGCCACCTGCA |
| Internal bar code: | TCAAACCCGAAGGGGTTCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1074 |
| LEAP-Seq percent confirming: | 97.882 |
| LEAP-Seq n confirming: | 647 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTTTCTTCAGGCTCCAG |
| Suggested primer 2: | GCACAAGAGCGAAGGAAAAC |