Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.194343 |
Chromosome: | chromosome 9 |
Location: | 6763679 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g409300 | (1 of 5) PF06863 - Protein of unknown function (DUF1254) (DUF1254) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTTGACGTCCAGGCCGTACGACACGAAC |
Internal bar code: | GTTGGGGGCGGCTTTCATTTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 642 |
LEAP-Seq percent confirming: | 73.9201 |
LEAP-Seq n confirming: | 907 |
LEAP-Seq n nonconfirming: | 320 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGGGGTTTGGCTAGTTCC |
Suggested primer 2: | GTGGGAGAGCACATGGAAAT |