| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.194530 |
| Chromosome: | chromosome 4 |
| Location: | 2277488 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g220300 | (1 of 6) IPR001680//IPR015943//IPR017986//IPR020472 - WD40 repeat // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain // G-protein beta WD-40 repeat | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGATGCGCTCACCTGTGTAGCTAGGCTC |
| Internal bar code: | TTAGGTCAGGACCCGTCAGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 602 |
| LEAP-Seq percent confirming: | 94.5083 |
| LEAP-Seq n confirming: | 740 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACTCATACGCATCCC |
| Suggested primer 2: | ACGAAAGGATGTACCGAACG |