| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.194591 |
| Chromosome: | chromosome 10 |
| Location: | 1290792 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427350 | CYP31,CYP39A2 | Cytochrome P450, CYP213 superfamily; (1 of 1) 1.14.13.79 - Ent-kaurenoic acid oxidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCAAACAGTCGAAGTTGCTTACATTCGC |
| Internal bar code: | GGCGTCCGAAGCAAGAACAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 454 |
| LEAP-Seq percent confirming: | 99.8344 |
| LEAP-Seq n confirming: | 3014 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCGCTAGTAGGATGACGG |
| Suggested primer 2: | TTTACAATCCCTCAGGACGC |