| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.194621 |
| Chromosome: | chromosome 6 |
| Location: | 7666423 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g301600 | MAN2,EDEM1 | a-1%252C2-mannosidase II putative; (1 of 1) K10085 - ER degradation enhancer, mannosidase alpha-like 2 (EDEM2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCAGGGCGCGGCCATGTGCGTGCGTTCT |
| Internal bar code: | CTTTCGATAGCCGGTAATTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 869 |
| LEAP-Seq percent confirming: | 99.2323 |
| LEAP-Seq n confirming: | 2456 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATAGCACCATCACCAACG |
| Suggested primer 2: | ATGAGGTACGCCTACAACGG |