| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.194785 |
| Chromosome: | chromosome 11 |
| Location: | 1628166 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467767 | NUO13 | NADH:ubiquinone oxidoreductase 18 kDa subunit; (1 of 1) K11352 - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 12 (NDUFA12) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAACCCCTCCTTGCCCCTGCCGCCGCTGC |
| Internal bar code: | GACGCGTATCGGTCCAAGCCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 244 |
| LEAP-Seq percent confirming: | 98.2906 |
| LEAP-Seq n confirming: | 460 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGGTCTGCAATTCACTC |
| Suggested primer 2: | TCAACGACTACAACCCCACA |