| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.194818 |
| Chromosome: | chromosome 12 |
| Location: | 9274673 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g541250 | NAR1E | Putative nitrite transporter; (1 of 7) PTHR30520//PTHR30520:SF0 - FORMATE TRANSPORTER-RELATED // FORMATE TRANSPORTER 1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCTTTGCCTACGGCAACAAGGGGCGGA |
| Internal bar code: | GGCGGCTATCCTACGCATACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 332 |
| LEAP-Seq percent confirming: | 85.3535 |
| LEAP-Seq n confirming: | 169 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGTACTCCCAGACTCACA |
| Suggested primer 2: | GCACGGTGTTGAGTAGCGTA |