| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.194878 |
| Chromosome: | chromosome 3 |
| Location: | 8444786 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g199647 | EIF4A,EIF4A3 | (1 of 1) K13025 - ATP-dependent RNA helicase (EIF4A3, FAL1); Eukaryotic translation initiation factor 4A3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGATGAGATGCTGGCCAAGAACTTCAA |
| Internal bar code: | CAATCGGCATCTGGGTAGGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 369 |
| LEAP-Seq percent confirming: | 79.8126 |
| LEAP-Seq n confirming: | 2641 |
| LEAP-Seq n nonconfirming: | 668 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACATGGAGGAGGATGAGGA |
| Suggested primer 2: | TGTTGCAGAAGATGACAGCC |