| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.194912 |
| Chromosome: | chromosome 12 |
| Location: | 1563533 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g486700 | FAP271 | (1 of 7) PF07004 - Sperm-tail PG-rich repeat (SHIPPO-rpt); Flagellar Associated Protein 271 | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGTGTGTTAAAGAGCACAAGGACCCCG |
| Internal bar code: | CTTTCGTCACATGCGCCATAAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 860 |
| LEAP-Seq percent confirming: | 99.3933 |
| LEAP-Seq n confirming: | 6225 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGCTAGCTCTGCCCATAC |
| Suggested primer 2: | TCGTAGATGGCTTGCAACTG |