| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.194985 |
| Chromosome: | chromosome 9 |
| Location: | 4166826 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394028 | (1 of 21) IPR000679 - Zinc finger, GATA-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGCCGGCAACAGCACCCGACACACCCGT |
| Internal bar code: | GGCGCACGCGCCCCAAATGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 279 |
| LEAP-Seq percent confirming: | 61.8635 |
| LEAP-Seq n confirming: | 1142 |
| LEAP-Seq n nonconfirming: | 704 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGACTGCTAGATAGGCACC |
| Suggested primer 2: | GGCTTAACCTAGGGCACACA |