| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.194987 |
| Chromosome: | chromosome 6 |
| Location: | 5810413 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g287600 | (1 of 7) PF12796//PF13637 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_4) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTCGACGCCGCTGCGAGTCCCCGAAGAG |
| Internal bar code: | AACATTTTCTGGCGCAGACGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 776 |
| LEAP-Seq percent confirming: | 99.4209 |
| LEAP-Seq n confirming: | 515 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAATCAGGGACGGTAGT |
| Suggested primer 2: | CCACCTTTTCGTGAGTCGAT |