Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.195026 |
Chromosome: | chromosome 1 |
Location: | 62029 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g000400 | AXL3,ERR1 | (1 of 6) PTHR10994:SF61 - RETICULON-LIKE PROTEIN; Arabinose chain extension enzyme like protein 3 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGTCGTGCCGCATCAACCACGAAACCGC |
Internal bar code: | CGTGGTGGCGGTCATCCGCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 737 |
LEAP-Seq percent confirming: | 99.474 |
LEAP-Seq n confirming: | 1891 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTGGTGACCTTTGACCTG |
Suggested primer 2: | TTAGCTGAGCAAAAGCACGA |