Insertion junction: LMJ.RY0402.195326_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.195326
Chromosome:chromosome_3
Location:8322497
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g199000 PHT1,PHOT,PHOT1 Phototropin antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTCGCAGGGGGCACTCCTCGCCCAACTGCT
Internal bar code:ACGTGAAGTCAGGCTATAATAC

Confirmation - LEAP-Seq

LEAP-Seq distance:719
LEAP-Seq percent confirming:99.5643
LEAP-Seq n confirming:457
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:TGGTCCACAACTTCCAAACA
Suggested primer 2:CTGGTTCAAGGGCATCAACT