| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.195387 |
| Chromosome: | chromosome 7 |
| Location: | 2392877 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g328550 | VPS18 | Subunit of the VPS-C complex; (1 of 1) PF05131 - Pep3/Vps18/deep orange family (Pep3_Vps18) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGAACTGAAGCGGACGGAGGGAGTTTGC |
| Internal bar code: | TCATACAACCGGGTCGACTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 130 |
| LEAP-Seq percent confirming: | 78.2895 |
| LEAP-Seq n confirming: | 238 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGTCGAGCTACAGCACA |
| Suggested primer 2: | GTACTGGCCGATCGACATCT |