| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.195457 |
| Chromosome: | chromosome 12 |
| Location: | 8686790 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g546400 | DLR2,DLC7b,DCL7B,LC7B | (1 of 2) K10419 - dynein light chain roadblock-type (DYNLRB, DNCL2); Roadblock/LC7 Family Light Chain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTTGTCCTGACCCCTGCTATGTCTCGGC |
| Internal bar code: | TTTTGGGCTTTATTAGCTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1178 |
| LEAP-Seq percent confirming: | 99.5208 |
| LEAP-Seq n confirming: | 623 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACCCAAGCGGTGACAGAC |
| Suggested primer 2: | TTCCATCGATTCATCGTCAA |