Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.195519 |
Chromosome: | chromosome_11 |
Location: | 2697757 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre11.g476850 | DRC4,PF2 | Component of dynein regulatory complex | antisense | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CCTGAACACCCTCGCACACTCCTCCTGGTG |
Internal bar code: | TGGCAGTATCAGCCGGGGTGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 598 |
LEAP-Seq percent confirming: | 99.8213 |
LEAP-Seq n confirming: | 2234 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTTCACTTCTGGCCTTGC |
Suggested primer 2: | CTATGCAACAAGCGATCGAA |