Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.195559 |
Chromosome: | chromosome 7 |
Location: | 256292 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g313950 | (1 of 14) PF04577 - Protein of unknown function (DUF563) (DUF563) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGGACGAGGGGACCGTGGCGGGTTTCC |
Internal bar code: | GAAGGCAAGCATGAGACAGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1032 |
LEAP-Seq percent confirming: | 98.6048 |
LEAP-Seq n confirming: | 2615 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAAGACGCGATTACGACAG |
Suggested primer 2: | GAACCACAGAAAGGTGCGAT |