| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.195577 |
| Chromosome: | chromosome 6 |
| Location: | 3083874 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g274650 | NUOAF4 | (1 of 3) IPR008979//IPR013857 - Galactose-binding domain-like // NADH:ubiquinone oxidoreductase intermediate-associated protein 30; Complex I intermediate-associated CIA30 protein, mitochondrial | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCCCTCCATGCTGTCGATCATGCCGGT |
| Internal bar code: | GTATGAGTTGTACCGCCCGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 574 |
| LEAP-Seq percent confirming: | 99.6858 |
| LEAP-Seq n confirming: | 3173 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACCCTGTGTCAGCTTGAG |
| Suggested primer 2: | ACGTAGAAGGTCGAGGCTGA |