| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.196005 |
| Chromosome: | chromosome 9 |
| Location: | 3954936 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g392542 | (1 of 1) K11423 - histone-lysine N-methyltransferase SETD2 (SETD2, SET2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACATCACCGCCATTGCTCTGCTCTGCT |
| Internal bar code: | ATGGCGAGATCAAACGGGTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 941 |
| LEAP-Seq percent confirming: | 99.2674 |
| LEAP-Seq n confirming: | 271 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGCTCGTGATGCATCTGT |
| Suggested primer 2: | TGTGTTGTTATCCCTTGCCA |