Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.196045 |
Chromosome: | chromosome 9 |
Location: | 634765 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403350 | (1 of 1) IPR000357//IPR016024//IPR021133 - HEAT repeat // Armadillo-type fold // HEAT, type 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTGACGGGCGTTGACTTTGACTTAAGGG |
Internal bar code: | TGGATAGGCGTGGCAAACGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 281 |
LEAP-Seq percent confirming: | 98.7842 |
LEAP-Seq n confirming: | 650 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCATAGCGACGTGCAGAAA |
Suggested primer 2: | TAGTTGATTGCTGGCTGTGC |