Insertion junction: LMJ.RY0402.196174_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.196174
Chromosome:chromosome_10
Location:1638048
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGAAGTTGGAGTAGAGCATGATCATGAAG
Internal bar code:GGCATCGTCATCTTTCTACAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:716
LEAP-Seq percent confirming:98.2487
LEAP-Seq n confirming:2244
LEAP-Seq n nonconfirming:40
LEAP-Seq n unique pos:10

Suggested primers for confirmation by PCR

Suggested primer 1:TGTTGAAGCGGATAGGAACC
Suggested primer 2:GCACGTGTTAGTCCCCAACT