Insertion junction: LMJ.RY0402.196174_1


Insertion cassette:CIB1
Side of cassette:3'
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre10.g429750 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGAAGTTGGAGTAGAGCATGATCATGAAG

Confirmation - LEAP-Seq

LEAP-Seq distance:716
LEAP-Seq percent confirming:98.2487
LEAP-Seq n confirming:2244
LEAP-Seq n nonconfirming:40
LEAP-Seq n unique pos:10

Suggested primers for confirmation by PCR