| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.196205 |
| Chromosome: | chromosome 7 |
| Location: | 2212720 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g327200 | (1 of 3) PF00534//PF13579 - Glycosyl transferases group 1 (Glycos_transf_1) // Glycosyl transferase 4-like domain (Glyco_trans_4_4) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAGGACGACCTGGGCGCATACCGCATCG |
| Internal bar code: | GGGCCCGTACGTATGTCGGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 265 |
| LEAP-Seq percent confirming: | 99.5575 |
| LEAP-Seq n confirming: | 225 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAGCTGGATGGCTAATGC |
| Suggested primer 2: | AAGGTTAGATTGCCCGGTTT |